Journal: Oncology Letters

Article Title: BLID is a drug-responsive target of FOXO3a and multi-omics analysis reveals survival mechanisms and therapeutic vulnerabilities in BLID-deficient breast cancer cells

doi: 10.3892/ol.2025.15155

Figure Lengend Snippet: RT-qPCR validation of changes in expression of a subset of genes following BLID knockdown. RT-qPCR analysis of several genes in (A) MCF-7 and (B) MDA-MB-231 cells. β-Actin served as the internal control. (A) The y-axis title of the middle graph is identical to the y-axis title of the left graph. (B) The y-axis title of the middle-left graph is identical to the y-axis title of the far-left graph. *P<0.05 and **P<0.01 (BLID shRNA vs. the corresponding Scr shRNA group), n=3. shRNA, short hairpin RNA; Scr, scramble control; Ctl, control; RT-qPCR, reverse transcription-quantitative PCR; BLID, BH-3 like motif containing inducer of cell death.

Article Snippet: In addition, Stealth siRNA negative control (scramble) with the same supplier's proprietary sequence designed to minimize sequence homology to any known vertebrate transcript (cat. no. 12935300, Thermo Fisher Scientific, Inc; Invitrogen) was used.

Techniques: Quantitative RT-PCR, Biomarker Discovery, Expressing, Knockdown, Control, shRNA, Reverse Transcription, Real-time Polymerase Chain Reaction

Journal: Frontiers in Oncology

Article Title: Bioinformatics and experimental unveiling of TIMP1 as a novel therapeutic target in colorectal cancer ferroptosis

doi: 10.3389/fonc.2025.1593107

Figure Lengend Snippet: TIMP1 promotes the proliferation and migration of CRC cells by inhibiting ferroptosis. (A) WB detected the effect of different transfection concentrations of TIMP1 on the protein expression of GPX4. RSL3 is a specific inhibitor of GPX4, which is used here as a positive control. (B) Clonal formation of two CRC cells after transfection of 100 nM TIMP1 siRNA in HCT-116 cells and SW480 cells. (C) Flow cytometry was used to detect cell death in two CRC lines after transfection of 100 nM TIMP1 siRNA. (D) WB was used to detect the protein expression of TIMP1 after TIMP1 was knocked down or re-adding recombinant TIMP1 protein. (E) WB was used to detect the expression of ferroptosis-related proteins GPX4 and SLC7A11 after knockdown of TIMP1 and re-addition of recombinant TIMP1 protein. (F) The transwell assay was used to detect the migration ability of CRC cells after knockdown of TIMP1 or re-addition of TIMP1 purified protein. Scale bar: 200 μm. The results of (A-F) were from three independent experiments. (G) Representative photograph of CRC xenograft tumors following stable TIMP1 knockdown, accompanied by corresponding statistical graphs depicting tumor weight and growth curves (n = 6). *P<0.05, **P<0.01, ***P<0.001 .

Article Snippet: Commercially synthesized siRNA targeting TIMP1 (siTIMP1) (sense: 5′→3′ UCAUAACGCUGGUAUAAGGUG; antisense: 5′→3′ CCUUAUACCAGCGUUAUGAGA) and scrambled negative control siRNA (siControl) were procured from Shanghai GenePharma Co., Ltd. (Shanghai, China).

Techniques: Migration, Transfection, Expressing, Positive Control, Flow Cytometry, Recombinant, Knockdown, Transwell Assay, Purification